Entre em contato com nossa equipe comercial gratuitamente pelo WhatsApp
Chamar no Whatsapp - KuadroChamar no WhatsApp

Questões de Biologia - UNICAMP 2017

ITA
IME
ENEM
FUVEST
UNICAMP
UNESP
ESPCEX
AFA
1-15 de 20
Questão 1
2017Biologia

Quando se pretende transformar a espécie X na espécie Y, ambas devem ser unidas por fertilização e, em seguida, os híbridos resultantes devem ser fertilizados com o pólen de Y. Depois, das várias proles resultantes, seriam selecionadas aquelas que apresentassem maior semelhança com Y, que novamente seriam fertilizadas com pólen de Y, e assim sucessivamente até que, finalmente, Y se mantivesse constante nas gerações seguintes. Por este processo, a espécie X teria sido transformada na espécie Y. (Adaptado de http://media.wix.com/ugd/b703be_02adaf2adad94fc08b146c5ab0e4b924.pdf. Acessado em 12/12/2016.) O trecho acima, adaptado da tradução do artigo de Gregor Mendel, ilustra o interesse de Mendel na transformação de espécies. a) O processo descrito por Mendel está relacionado com que prática amplamente usada na agricultura? Quais as vantagens da utilização desse processo na agricultura? b) Considerando que a espécie X tenha as características A e B, que a espécie Y tenha as características a e b e que os alelos A e B são dominantes, a partir do cruzamento de X com Y, em quantas gerações todos os descendentes resultantes teriam apenas as características ab? Quais seriam os genótipos formados em cada uma das gerações?

Questão 2
2017Biologia

Em 2016 verificamos as consequências do derrame de grande volume de rejeitos de uma mineradora, que se espalhou pelo mar a partir da foz do rio Doce. Os resíduos formaram uma mancha móvel que alterou o equilíbrio do rio, do mar e impactou a economia local dependente da pesca. a) Qual foi a consequência do avanço da lama na biodiversidade do ambiente marinho? Justifique. b) Cite dois fatores decisivos para a recuperação da ictiofauna do rio Doce.

Questão 3
2017Biologia

A esquistossomose mansônica é uma doença que afeta 7 milhões de brasileiros atualmente. A vacina contra este helminto está em fase pré-clínica de testes e foi desenvolvida por pesquisadores brasileiros. a) Quais são as formas infectantes para o hospedeiro vertebrado e para o hospedeiro invertebrado? Indique esses hospedeiros. b) Vacinas são estratégias profiláticas importantes no combate a infecções, porém, até o momento, não existem vacinas contra essa parasitose. Cite duas medidas profiláticas efetivas para o controle dessa infecção no homem.

Questão 4
2017Biologia

A figura acima mostra duas reações perante os insetos mencionados, sob pontos de vistas diferentes. a) Construa uma teia alimentar completa que inclua os organismos retratados na figura. b) Considerando que insetos são, em geral, pobres em gorduras e açúcares, qual é a principal fonte de energia oriunda da ingestão de formigas? O que acontece com esse nutriente no estômago humano?

Questão 5
2017Biologia

As plantas crescem e se desenvolvem em ambientes com grande variação na disponibilidade de energia luminosa, apresentando importante aclimatação da fotossíntese e da respiração foliar. A figura abaixo representa a variação das trocas gasosas de duas espécies, A e B, em função do aumento da disponibilidade de luz. Valores positivos indicam fotossíntese e valores negativos, respiração. a) Qual espécie estaria mais apta a se desenvolver em ambientes de sub-bosque, onde a luz é um fator limitante e raramente excede 200 mol m-2s-1? Justifique sua resposta. b) Além de modificações fisiológicas como as citadas nas trocas gasosas, cite outras duas características das folhas que tornariam as plantas aptas a se desenvolverem em ambientes sombreados.

Questão 6
2017Biologia

A biotecnologia está presente em nosso dia a dia, contribuindo de forma significativa para a nossa qualidade de vida. Ao abastecer um automóvel com etanol, estamos fazendo uso de um produto da biotecnologia obtido com a fermentação de açúcares presentes no caldo extraído da cana-de-açúcar. Após a extração do caldo, uma quantidade significativa de carboidratos presentes na estrutura celular é perdida no bagaço da cana-de-açúcar. A produção de etanol de segunda geração a partir do bagaço seria uma forma de aumentar a oferta de energia renovável, promovendo uma matriz energética mais sustentável. a) Cite um carboidrato presente na estrutura da parede celular da cana-de-açúcar que poderia ser hidrolisado para fornecer os açúcares para a obtenção de etanol. Por que a biomassa é considerada uma fonte renovável de energia? b) Como os micro-organismos atuam na fermentação e se beneficiam desse processo?

Questão
2017Biologia

(UNICAMP - 2017)Na vida real não existem animais que são agentessecretos, mas o ornitorrinco, representado na figura dodesenho Phineas e Ferb, guarda muitos segredos ecuriosidades. Esse animal de aproximadamente 60 cm,que parece uma mistura de lontra, pato e castor, resultouem um ser único em vários sentidos.

Questão
2017Biologia

(UNICAMP - 2017)A figura a seguir ilustra fragmentos de um gene presente em 4espécies identificadas com os números de 1 a 4 entreparênteses. CACTTGTAAAACCAGTATAGACCCTAG(1) CACTTGTAAAACCAGGATAGACGCTAG(2) CACTTGTAAAACCAGTATAGACGCTAG(3) CATTTTTAACACCAGGATAGACGCTAT(4) Assinale a alternativa correta.

Questão
2017BiologiaQuímica

(UNICAMP - 2017)Muitos problemas sociais e ambientais têm-se tornado motivode piadas e alvo de charges em jornais e revistas. Um exemplodeste tipo está mostrado nas figuras abaixo. Levando em conta as informações abstraídas das figuras,depreende-se que as charges remetem a um problemarecorrente de contaminação de

Questão
2017Biologia

(UNICAMP - 2017) O HPV faz parte do grupo dos caudovírus. As verrugas genitaiscausadas pela infecção do vírus foram estudadas desde aAntiguidade, porém o vírus só foi descoberto 40 anos atrás.Pode-se afirmar corretamente que:

Questão
2017Biologia

(UNICAMP - 2017)O corpo humano é composto por pelo menos dois tipos degordura. A mais comum é o tecido adiposo branco, um tipoperigoso que se acumula ao redor das vísceras e debaixo dapele, podendo causar obesidade e desencadear complicaçõesmetabólicas, como o diabetes tipo 2. A outra é o tecido adiposomarrom, que regula a produção de calor e, consequentemente,a temperatura corporal. Assinale a alternativa correta.

Questão
2017Biologia

(UNICAMP - 2017)Ao observar uma célula, um pesquisador visualizou umaestrutura delimitada por uma dupla camada de membranafosfolipídica, contendo um sistema complexo de endomembranas repleto de proteínas integrais eperiféricas. Verificou também que, além de conter seupróprio material genético, essa estrutura ocorria emabundância em todas as regiões meristemáticas deplantas. Qual seria essa estrutura celular?

Questão
2017Biologia

(Unicamp 2017) A figura a seguir ilustra fragmentos de um gene presente em 4 espécies identificadas com os números de 1 a 4 entre parênteses. Assinale a alternativa correta.

Questão
2017Biologia

(UNICAMP 2017) O gráfico a seguir representa a variação do índice glicêmico após a ingestão de dois alimentos (mesma quantidade, pela mesma pessoa, mas em momentos diferentes). A linha pontilhada representa o alimento A, enquanto a linha contínua representa o alimento B. A análise do gráfico nos permite afirmar corretamente que:

Questão
2017Biologia

(Unicamp 2017) Pesquisadores analisaram o número de polinizadores, a biodiversidade e o rendimento de cultivos dependentes de polinizadores (maçã, pepino, caju, café, feijão, algodão e canola, entre outros) em propriedades da África, Ásia e América do Sul. Nos países analisados, o rendimento agrícola cresceu de acordo com a densidade de polinizadores, indicando que a redução na população de abelhas e outros insetos poderia ser parcialmente responsável pela queda de produtividade. Adaptado de http://revistapesquisa.fapesp.br/2016/01/21/insetos-elevam-produtividade-agricola/. Os resultados obtidos com a pesquisa relatada acima sugerem que:

NOVIDADES
Kuadro